Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 60699469 60718141 enh62472

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 60708404 rs373035329 T TCAAGTGATTCTCCTGCCTC 3999729
chr15 60708404 rs71122857 T TCAAGTGATTCTCCTGCCTC 3999730

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results