Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68695805 68701928 enh52061

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68701128 rs538725991 CCTGCCATCCTGCCAGGCTCCTTGA C 4051162

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results