Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99554485 99565188 enh44220

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99558694 rs199834486 GCGCAGAGGTGGAGCGGGTCGGGGT G 4223044
chr15 99558703 rs529523822 T C 4223045

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results