EnhancerDB
  1. Home
  2. TFBS
  3. TEAD2[chr15:102111632-102111636]
Chromosome characteristics of TEAD2[chr15:102111632-102111636]
Back to top
Enhancers possibly regulated by TEAD2[chr15:102111632-102111636]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 102103105 102122329 enh31659
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Colon (HCT116) Lung (PC-9) Pancreas Muscle (Myotube)
SNP sites on TEAD2[chr15:102111632-102111636]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 102111634 rs564232305 ATAAGGAAACAACATTGAACAAAACGTTATTCGAGGACCTGCTG A 4242620
Genes possibly regulated by TEAD2[chr15:102111632-102111636]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TEAD2[chr15:102111632-102111636]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results