Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 837770 854215 enh49633

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 842057 rs149865693 A AAACTCAGCTGCCTCTCCCCTTC 741

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results