Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3034325 3059175 enh49637

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3045232 rs147796784 CTCCCACCATGCTACTGGAGACCA C 17477
chr1 3045232 rs373575617 CTCCCACCATGCTACTGGAGACCA C 17478

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results