Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3626242 3638555 enh47129

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3635112 rs147565379 GGCAGGGGCCTAGGGGAGGGGCT G 25113
chr1 3635112 rs369344777 GGCAGGGGCCTAGGGGAGGGGCT G 25114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results