Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 7775905 7784575 enh42867

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 7778276 rs191265777 C T 48869
chr1 7778276 rs556405315 CGTTCCGTAAACACAGTGGGT C 48870

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results