Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 8339985 8347435 enh11469

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 8342217 rs576563761 CCACACTGGCCAGTGTGGGACCTCT C 54390
chr1 8342217 rs70990549 CCACACTGGCCAGTGTGGGACCTCT C 54391

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results