Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 8561260 8579415 enh45

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 8575439 rs72867534 G A 56700
chr1 8575444 rs577838565 TGGTGGCTCACCTGAGGCAGGCAGGTCA T 56701

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results