| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 8902474 | 8911343 | enh42870 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 8908177 | rs376310807 | G | GACACAGCTGCAC,GCTGGCCATGCCACACACAGCTGCAC | 59547 | |
| chr1 | 8908177 | rs376727923 | G | GCTGGCCATGCCACACACAGCTGCAC | 59548 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|