EnhancerDB
  1. Home
  2. TFBS
  3. RUNX2[chr1:8908166-8908181]
Chromosome characteristics of RUNX2[chr1:8908166-8908181]
Back to top
Enhancers possibly regulated by RUNX2[chr1:8908166-8908181]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 8902474 8911343 enh42870
Large Intestine Prostate (RWPE1) Esophagus Stomach Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Heart
SNP sites on RUNX2[chr1:8908166-8908181]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 8908177 rs376310807 G GACACAGCTGCAC,GCTGGCCATGCCACACACAGCTGCAC 59547
chr1 8908177 rs376727923 G GCTGGCCATGCCACACACAGCTGCAC 59548
Genes possibly regulated by RUNX2[chr1:8908166-8908181]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RUNX2[chr1:8908166-8908181]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results