Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 10555285 10560515 enh107369
chr1 10558276 10558621 vista328

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 10558337 rs371377667 TAAAACAAAACAAAACAAAAC T 72221
chr1 10558337 rs539042222 TAAAACAAAAC T 72222
chr1 10558337 rs551395151 TAAAACAAAACAAAACAAAAC T 72223

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results