Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 58230485 58242115 enh54143

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 58232432 rs568030868 A AAGGAGATAAGAATTTGTGGTT 6761430

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results