Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15103385 15116455 enh49661

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 15106055 rs551056957 A AATACTAAACAAATGAGATGTAGGT 98853
chr1 15106057 rs1473680 T C 98854

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results