Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15847805 15851955 enh98427

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 15848265 rs368386421 CTGTCTTTTTTTCTATCTCTTTCTCCTG C 105880
chr1 15848265 rs550358054 CTGTCTTTTTTTCTATCTCTTTCTCCTG C 105881

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 15817327 15853029 - CASP9 ENSG00000132906.13 15853029 0.85 1.0 4760 209


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results