EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr1:15851062-15851067]
Chromosome characteristics of GATA2[chr1:15851062-15851067]
Back to top
Enhancers possibly regulated by GATA2[chr1:15851062-15851067]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15847805 15851955 enh98427
Uterus
SNP sites on GATA2[chr1:15851062-15851067]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 15851064 rs4645982 A ATCCCCGCACTGACCTCACG 105936
chr1 15851064 rs59278072 A ATCCCCGCACTGACCTCACG 105937
Genes possibly regulated by GATA2[chr1:15851062-15851067]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 15817327 15853029 - CASP9 ENSG00000132906.13 15853029 0.85 1.0 1962 209
chr1 15853308 15918874 + DNAJC16 ENSG00000116138.8 15853308 0.81 0.99 2241 210
Expression level of Genes
Back to top
miRNAs possibly regulated by GATA2[chr1:15851062-15851067]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results