EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr1:17050484-17050505]
Chromosome characteristics of ZNF263[chr1:17050484-17050505]
Back to top
Enhancers possibly regulated by ZNF263[chr1:17050484-17050505]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 17049825 17059510 enh89
Bone Marrow (K562) Brain (SK-N-MC) Blood (OCI-LY7) Colon (HCT116) Blood (Karpas-422) Neural Stem Cells (H9)
SNP sites on ZNF263[chr1:17050484-17050505]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 17050485 rs552505919 AGGGGAGGAGATGATAGAATAT A 113952
chr1 17050493 rs541922392 AGAT A 113953
chr1 17050493 rs58403296 AGAT A 113954
chr1 17050493 rs63228660 AGAT A 113955
chr1 17050499 rs2002674 T C 113956
chr1 17050505 rs33944305 AT A 113957
Genes possibly regulated by ZNF263[chr1:17050484-17050505]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr1:17050484-17050505]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results