EnhancerDB
  1. Home
  2. TFBS
  3. AR[chr1:17231880-17231895]
Chromosome characteristics of AR[chr1:17231880-17231895]
Back to top
Enhancers possibly regulated by AR[chr1:17231880-17231895]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 17219841 17243115 enh90
Cervix (HeLa-S3) Prostate (RWPE1) Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas (Panc1) Uterus Thymus
SNP sites on AR[chr1:17231880-17231895]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 17231888 rs74055972 G C,T 114664
chr1 17231889 rs563957391 A T 114665
chr1 17231894 rs71003299 T TCCTTAGCGGATCCTTGGTAACGCTA,TCCTTAGGGGATCCTTGGTAACGCTA 114666
Genes possibly regulated by AR[chr1:17231880-17231895]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by AR[chr1:17231880-17231895]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results