Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 17219841 17243115 enh90
chr1 17240188 17240783 vista545

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 17240551 rs150160215 TCCCCGCCCCGTGGCGGGGACG T 114840

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results