Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 24704149 24722895 enh138

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 24721868 rs376699971 TAAATATGTGGGTAAATAGA T 165358

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results