EnhancerDB
  1. Home
  2. TFBS
  3. MEIS3[chr1:24891773-24891781]
Chromosome characteristics of MEIS3[chr1:24891773-24891781]
Back to top
Enhancers possibly regulated by MEIS3[chr1:24891773-24891781]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 24883605 24896815 enh11621
Prostate (PC-3) Liver (HepG2) Brain (SK-N-MC) Large Intestine Stomach Placenta Thyroid Peripheral Blood (MM.1S) Lung (PC-9) Pancreas Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on MEIS3[chr1:24891773-24891781]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 24891775 rs112704151 TGACAGGGAACTGTTGAATTCAAG T 166261
chr1 24891775 rs56244236 TGACAGGGAACTGTTGAATTCAAG T 166262
Genes possibly regulated by MEIS3[chr1:24891773-24891781]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEIS3[chr1:24891773-24891781]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results