Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 26741479 26747975 enh11653

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 26742176 rs11268515 GCTGGGCACAACATAGAATATGGC G 180236
chr1 26742176 rs72450341 GCTGGGCACAACATAGAATATGGC G 180237

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results