Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 27720012 27730415 enh11665

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 27727915 rs151074274 TGTCATGGTTCCAACACAAAA T 185534
chr1 27727915 rs372179428 TGTCATGGTTCCAACACAAAA T 185535

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results