EnhancerDB
  1. Home
  2. TFBS
  3. TP63[chr1:32703155-32703175]
Chromosome characteristics of TP63[chr1:32703155-32703175]
Back to top
Enhancers possibly regulated by TP63[chr1:32703155-32703175]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 32698385 32707335 enh208
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Blood (Karpas-422) Muscle (Myoblast) Pancreas Muscle (Myotube)
SNP sites on TP63[chr1:32703155-32703175]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 32703160 rs535702545 ATGTGCCATCACGCCCGGCTAATTTTGTATTTTT A 217367
Genes possibly regulated by TP63[chr1:32703155-32703175]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TP63[chr1:32703155-32703175]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results