| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 51439185 | 51454555 | enh353 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 51443758 | rs546664774 | GGGGAGCGGGCGCCGGCGCCTCCCGGCCGCCGGCGCAGCGCCCC | G | 303552 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 51525744 | 51525764 | + | hsa-miR-6500-3p | MIMAT0025455 | 51435925 | 0.0 | 0.0 | 7822 | 42 |