Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 54709082 54722240 enh42965

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 54718191 rs146044344 CGGGACAGGTGGCCACTAGGAGA C 318499
chr1 54718191 rs375647969 CGGGACAGGTGGCCACTAGGAGA C 318500

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results