Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 95233265 95241955 enh26976

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 95238346 rs367695299 GAGCTGAGATCGCACCATTGCACTCC G 498558

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results