Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110727265 110733875 enh12134

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110729810 rs11267498 TGAACAATTCGCTAATCAGGCA T 551256
chr1 110729810 rs71580525 TGAACAATTCGCTAATCAGGCA T 551257

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results