| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 110924110 | 110930935 | enh556 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 110930441 | rs111878697 | T | TA,TTTCTAGGGGGAAAATGAGATTCCCCTAAAATAACATA | 552434 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 110905470 | 110933704 | - | SLC16A4 | ENSG00000168679.13 | 110933704 | 0.95 | 0.92 | 3251 | 999 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|