Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 114685305 114694133 enh67105

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 114691845 rs531593752 G GTGTGTGTGTGTGTGTGTGCGCGCA 573614

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 114631913 114696541 - SYT6 ENSG00000134207.10 114696541 0.91 1.0 4678 1042


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results