Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 154729885 154735135 enh47241

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 154733324 rs568770881 G GCGCGCCCGCGAAGAAGCACTCCGGCCC 640375

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results