Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156419365 156433115 enh657

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156426574 rs532602661 T TTGGCTGATGATTCCGTCTGCCAC 648510

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results