Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156860185 156870715 enh12303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156867951 rs545672693 GGGGATGACAATCACCAGCACCTTCCA G 651601

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results