Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167062665 167082157 enh12346

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167080728 rs140475448 TATATATATATATATATATATATACAC T 699457
chr1 167080728 rs751268557 TATATATATATATATATATATATACAC T 699458

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results