Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167892105 167897968 enh64121

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167896903 rs572962307 GGTTGATCCTTTGGGGTTAATA G 706062

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results