Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 168193145 168198695 enh98556

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 168195443 rs571577249 G GGCCTGGGAAGCCTGCGGGGACT 707144

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 168195176 168222263 + SFT2D2 ENSG00000213064.5 168195176 0.68 0.99 254 1539


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results