Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 178831505 178838095 enh98582

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 178836920 rs563842865 T TAGTTATATATCTAACCTATGATTATGGACC 757060

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 178818840 178840187 - ANGPTL1 ENSG00000116194.8 178840187 0.8 1.0 3267 1603


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results