Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 180275825 180282838 enh27291

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 180276532 rs575301563 TAATGGGTACAAAAAAATTGTTACA T 763409

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results