Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 180449665 180457755 enh783

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 180456203 rs577795963 ACATGACAACTAAATACGATG A 764020

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results