Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 186526785 186531215 enh58189

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 186529400 rs373251466 A ATCCCCCAGAAGGCATTTGTTATG 799247
chr1 186529400 rs576479172 A ATCCCCCAGAAGGCATTTGTTATG 799248

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results