Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 200005765 200009915 enh98594

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 200008077 rs540203494 ACCCCTCAATCCAGCCTTCC A 844322

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results