Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 203547785 203555455 enh12560

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 203554067 rs141898992 CTGGACAATACCTCCAATTCAAA C 869689

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results