Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 203881465 203891816 enh12569

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 203885622 rs147209549 G GAGCCACTGCACCCAGCCCATT 872142

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results