Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 209209125 209227456 enh27445

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 209222586 rs140200364 G C 903314
chr1 209222586 rs535703278 G GCATTCCCCGCATATTTTTC 903315

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results