Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 210403265 210410875 enh98604

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 210406243 rs549750813 GGGCGGCCGGGCCGGGACCCGCGAGTGTGCACC G 910627
chr1 210406245 rs2273048 G A 910628

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 210406144 210419976 + SERTAD4 ENSG00000082497.7 210406144 0.77 0.97 98 1814


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results