Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 210444205 210448355 enh109382

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 210444949 rs144953746 GGGTCATTTGCAGACATGCACAGA G 910939
chr1 210444949 rs374253675 GGGTCATTTGCAGACATGCACAGA G 910940

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results