Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 210511765 210519135 enh74482

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 210518236 rs11273573 TCATCGGAACAAGTCATGCCGG T 911543
chr1 210518236 rs68138782 TCATCGGAACAAGTCATGCCGG T 911544

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results