EnhancerDB
  1. Home
  2. TFBS
  3. T[chr1:226720046-226720062]
Chromosome characteristics of T[chr1:226720046-226720062]
Back to top
Enhancers possibly regulated by T[chr1:226720046-226720062]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 226719025 226723255 enh50229
Pancreas Large Intestine Stomach
SNP sites on T[chr1:226720046-226720062]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 226720060 rs138320499 CCACCAAGGACTCCTAGACTGTG C 992706
chr1 226720060 rs61211904 CCACCAAGGACTCCTAGACTGTG C 992707
Genes possibly regulated by T[chr1:226720046-226720062]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by T[chr1:226720046-226720062]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results