EnhancerDB
  1. Home
  2. TFBS
  3. SRF[chr1:227736792-227736810]
Chromosome characteristics of SRF[chr1:227736792-227736810]
Back to top
Enhancers possibly regulated by SRF[chr1:227736792-227736810]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 227726365 227737955 enh12735
Bone (Osteoblast) Lung Placenta Pancreas Uterus Blood (T-cell)
SNP sites on SRF[chr1:227736792-227736810]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 227736798 rs140954732 C CTATACATGGAATCTTTTCCA 998678
chr1 227736798 rs71180758 C CTATACATGGAATCTTTTCCA 998679
chr1 227736798 rs777074644 C CTATACATGGAATCTTTTCCA 998680
Genes possibly regulated by SRF[chr1:227736792-227736810]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SRF[chr1:227736792-227736810]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results