EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2A[chr1:228669611-228669622]
Chromosome characteristics of TFAP2A[chr1:228669611-228669622]
Back to top
Enhancers possibly regulated by TFAP2A[chr1:228669611-228669622]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 228664265 228669755 enh102912
Liver Peripheral Blood (MM.1S) Blood (T-cell) Stomach
SNP sites on TFAP2A[chr1:228669611-228669622]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 228669612 rs141479548 AGCCTGGGGGACAGAGTGAGACT A 1002968
chr1 228669612 rs372245711 A G 1002969
Genes possibly regulated by TFAP2A[chr1:228669611-228669622]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2A[chr1:228669611-228669622]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results